Hydrogen Fuel Cell Essay Example | Topics and Well Written Essays - 1500 words

Hydrogen Fuel Cell - Essay Example The end of inexpensive sources of energy, brought about largely by the Arab oil boycott, made the search for energy alternatives imperative. Several companies are developing fuel cells that they hope will replace conventional internal-combustion engines in automobiles over the next few decades. According to a report fuel cell developers nowadays, even government agencies, and automakers are working hard to accelerate the introduction of fuel cell toward commercialization. What is fuel cell all about How effective it is According to a website "A fuel cell is an electrochemical device that combines hydrogen and oxygen to produce electricity, with heat and water as its by-product. As long as fuel is supplied, the fuel cell will continue to generate power. It produce electricity through electrochemical reactions. No other energy generation technology offers the combination of benefits that fuels cells do. In addition to low or zero emissions, benefits include high efficiency and reliability, multi-fuel capability, durability and ease of maintenance." It aims to have a clean transport for the future. Fuel-cell technology that promises to revolutionize the global car business is now coming to market" according to a newspaper article. Fuel-cell technology is particularly suitable for city buses because it offers much lower noise levels and has no polluting emissions. Efficiency of Fuel Cells Many large automakers are now adapting fuel cell technology for automobiles. It is proved as a good substitute to gasoline. It is found cleaner, because of hydrogen. Fuel cells produce only pure water as exhaust. It only produce far less pollution than conventional technologies. Quieter, vibration free and more energy efficient than internal-combustion engines. Fuel cells combine hydrogen and oxygen electrochemically without combustion to supply electricity. Fuel cell engines will likely run on conventional gasoline, but with a fraction of the emissions of a normal engine. The fuel cell is also being explored as a way to generate electricity. In a fuel cell, hydrocarbons are combined with oxygen to produce electricity directly, much the same way lead is consumed to make electricity in a storage battery. Fuel cells are more efficient than conventional power plants because there are no turbines or other mechanical devices to waste energy through friction or heat. The website added (www .fuelcelltoday.com) "Operating times are much longer than with batteries, since doubling the operating time needs only doubling the amount of fuel and not the doubling of the capacity of the unit itself." Until now, fuel cells have been small devices. However, the Pratt and Whitney Aircraft Division of the United Aircraft Corporation is planning a 26 megawatt portable fuel cell generator that will produce enough electrical power for 20,000 people. This plant is designed to use natural or synthetic gas and to provide an economical and pollution-free means for power companies to meet peak load demands. According to Fuel Cell Market, fuel cells are found "Reliable. Because the absence of combustion and moving parts means that fuel cell technologies are expected to provide much improved reliability over traditional

Marketing Mix Analysis of iPad Essay Example for Free

Marketing Mix Analysis of iPad Essay Executive Summary Managing and developing marketing mix appropriately is extremely important to firms marketing and success. In order to marketing product successfully, the right product must be exhibited to right people at the right place, right price and right time. If a firm can manage the marketing mix successfully, as a result, it can be a source of competitive advantage for firms. Each element of the marketing mix should be analyzed and if necessary, adapted to ensure that the right balance is achieved to give the product or service the very best chance of success in the market place. Apple is a successful company and its previous product iPod has a high market share in the global market due to its brand perception and image as s high quality innovative brand. In 2010, Apple launched an innovative product – â€Å"iPad† in US, which is a tablet computer with touch screen. Even in the first launching date iPad had been sold 0.3 million units. The product no doubt is getting support of Apple’s brand image and it has changed the way to consumer lifestyle. That is why iPad is thought as a revolutionary who will arouse a wave to electronic industry. Apple’s iPad delivered the value to the customer via marketing mix tools called the 4Ps: * Product looks good and works well. * Right price. * Right place at the right time. * Successful promotion helps to a larger output. Apple followed this by innovation and introducing new products in the market to satisfy consumer’s needs and wants. The current author here will use the theories, concepts of marketing mix to analysis the iPad. The remainder of this essay is structured into five parts. It begins by defining marketing mix and its evolution. Second, it analyse the company, iPad, its competitor and consumer. Third, it illuminates the marketing mix by analysing iPad. Finally it ends with the overall assessment and conclusion. Contents 1.Introduction and Definition3 1.1Definition of Marketing3 1.2Definition of Customer Value and Value Proposition3 1.3Definition of Marketing Mix4 2.Description of Apple iPad4 2.1Brief Introduction of Apple4 2.2Introduction of iPad5 2.3Brief Consumer Profile6 2.4Brief Competitor Profile7 3.Marketing Mix Analysis of iPad7 3.1Product7 3.2Price10 3.3Place12 3.4Promotion14 4.Assessment of Overall Value Delivered16 5.Conclusion16 6.References18 1. Introduction and Definition 2.1 Definition of Marketing â€Å"Marketing is the process by which individuals and groups obtain what they need and want through creating and exchanging products and value with others and forging relationships with customers.† (Philip Kotler, Gary Armstrong, 2009). This definition recognizes the importance of creating a long term relationship with customers and identifies the importance of satisfying customer wants. 2.2 Definition of Customer Value and Value Proposition Customer value is the difference between the values that the customer gains from owning and using a product and the costs of obtaining the product. Put it simply, customer value is created when the perceptions of benefits received from a transaction exceed the costs of ownership. The same idea can be expressed as a ratio (Chiristopher, 1996): Customer value = Perceptions of benefits The definition of customer value proposition is a well defined and persuasive marketing statement related to a specific product or service that details the reasons why a consumer would benefit from purchasing it. A value proposition is the definition of a firms promise to create and deliver customer value (Chapelet and Tovstiga, 1998). Fig 1.2.1 A model of value creation and the marketing process source: Adapted from Kotler Brown Burton Deans Armstrong, (2010), â€Å"Marketing† 8th Edition Figure 1.2.1 shows a typical model of value creation and the marketing process. Put it simple, marketing is a process cycle which consists of 5 simple steps as below: i. Customer buys or potential customer is contacted to understand the marketplace. ii. Finding out how the customer liked the product or what is needed. iii. Analysing these data and creating a plan that includes goals, strategy and its marketing mix. iv. Implement the plan that delivers value to customer which results in the customer’s buying the product and creating customer delight. v. Repeating the cycle starting with step (i) to step (iv) to make a better product sold with a better plan and continuously keeping this cycle going. Hence, create profits and customer equity. 2.3 Definition of Marketing Mix The concept of the Marketing Mix was first created by Neil H. Borden in his article called â€Å"The concept of the Marketing Mix† in 1964. In his article he explained the importance of a market to try to â€Å"mix ingredients† in their process in the market in order to be successful. E. Jerome McCarthy later grouped these ingredients into the four categories that are known as the 4Ps of marketing (Product, Price, Place and Promotion). Product What does the customer want from the product/service? Price What is the value of the product or service to the buyer? Place Where do buyers look for the product or service? Promotion Where and when can get across the marketing messages to target market? 2. Description of Apple iPad 3.4 Brief Introduction of Apple Apple Inc., founded in 1976, is an American multinational corporation which is best-known for its hardware and software products. The hardware products are: Macintosh, iPod, iPhone and iPad. One example of the famous software of Apple is iTunes, a proprietary media player application that works with iTunes store and allows customers to download music and offers other features of consumer electronics. Fortune magazine named Apple as the most admired company in the US in 2008, and in the world from 2008 to 2012. 3.5 Introduction of iPad On January 27, 2010, Apple introduced the much-anticipated media tablet, the iPad (As shown in Fig2.2.1). Fig 2.2.1 Introduction of iPad (source: www.apple.com) The iPad measure 9.7 inch wide screen display with multi touch screen with 1024 x 768 resolutions which is lighter and thinner than any other notebooks or laptops. Its internal 25 watt-hour battery can run up to 10 hours of video, 140 hours of audio playback and one month on standby as Apple claims. Steve Jobs stated that, with the introduction of the iPad, Apple had opened a market for a new class of mobile devices. (As shown in Fig 2.2.2) Fig2.2.2 Apple iPad First Hands-on (source: http://www.ipadforums.net) 3.6 Brief Consumer Profile Consumer market can be defined as â€Å"all the individuals and households who buy or acquire goods and services for personal consumption† and consumer buying behavior can be defined as â€Å"the buying behavior of final consumers, individuals and households who buy goods and services for personal consumption† (Kotler, 2009). Table 2.3.1 shows the analysis of market segmentation for iPad. SEGMENTATION BASE| SELECTEDSEGMENTATION VARIABLES| Geographic Segmentation| Region| West Malaysia, east Malaysia| City size| Major metropolitan areas, cities| Density of area| Urban| Climate| Hot, humid, rainy| Demographic Segmentation| Age| 18-34, 35-49, 50-64| Sex| Male, female| Married status| Single, married, divorced, living together| Income| RM40,000 and over| Education| College, college graduate, postgraduate| Occupation| Professional, white-collar| Psychological| Needs| Sense of self-worth, fashionable| Personality| Extroverts, novelty-seeker, aggressives| Perception| Low-risk| Learning-involvement| High-involvement| Attitudes| Possitive attitude| Psychographic| Lifestyle| Couch-potatoes, outdoor enthusiasts, status-seekers| Cultures| Malay, Chinese, Indian, and other foreigners| Religion| Muslim, buddhism, hinduism, christian, catholic, and others| Social| Middle, upper| Family| Bachelors, young married, full nesters, empty nesters| Use-Rated Segmentation| Usage rate| Heavy users, medium users| Awareness status| Aware, interested, enthusiastic| Brand loyalty| Strong| Use-Situation Segmentation| Time| Leisure, work, morning, night| Objective| Personal, fun, achievement| Location| Home, work, mega mall, restaurant| Person| Self, family members, friends, peers| Benefit Segmentation| Convenience, social acceptance, easy e-book reading, value-for-the-money, service| Table 2.3.1 Market segmentation for iPad From analysis above can see that most of Apple’s users are high-end clients who have the strong purchasing power, easily accept new technology and they are very loyal to Apple. 3.7 Brief Competitor Profile Apple iPad bring threats and impact to PC industry in some way. On one hand, the hot-sell of iPad attracts many PC manufacturers set foot in this field. So the other tablet computers will be the biggest competitor, such as Blackberry’s playbook, this is a tablet computer which located in business person, and it will also attract public’s eyes because of its vast multimedia function. On the other hand, the price advantage of netbook is also a challenge to iPad. After all compared with traditional computer, iPad may not a necessity. To some business and professional people, they will choose the traditional notebook rather than iPad. 3. Marketing Mix Analysis of iPad According to the information that searches from magazines and internet, the author knows many information of iPad. The author here will use the theories, concepts of marketing mix to analysis the iPad. 4.8 Product â€Å"Product means the goods-and-services combination the company offers to the target market. â€Å" (Philip Kotler, Gary Armstrong, 2009). The iPad bridges the gap between smart phone and laptop, it offers equivalent range of features and functions that a computer does. It has internet capabilities running on both Wi-Fi and 3G. Some of the features are discussed previously. Fig 3.1.1 shows its tech specs. Access to Apple Apps Store which has over 300,000 applications and to iTunes are attractive features of iPad. Fig 3.1.1 Tech Specs for Apple iPad (source: http://www.apple.com) Value delivered to customer: 1) Convenient to Carry and Easy to Use Compared to functionalities and performance, it is surprised that iPad weighs only 1.5 pounds. It is very thin and sleek measuring only 0.5 inches. This lightweight iPad is very useful for business trip, making it easy to transport as compared to a laptop. Not only it is easier to carry it around, but also be able to use it to check e-mails, show videos and photos to people instantly whenever required with its long battery life, which at 10 hours is 2-5 times longer than a notebook (As shown in Fig 3.1.2). Fig 3.1.2 E-mail and photo function for iPad (source: http://www.cnbeta.com) 2) Easy for E-Book Reading One benefit that can’t miss is the iBooks Application. Customer can download the favorite e-books to iPad and read while traveling (As shown in Fig 3.1.3). Fig 3.1.3 E-books on Apple iPad (source: http://www.telegraph.co.uk) Retrieving books to read on ibooks application on iPad is simply easy. Browse through the e-bookshelf on the iPad, choose one title wish to read and click, the book opens in front. Customer can view the book in portrait or landscape, and the way the pages flip is awesome flip it with finger and looks just like a real book. 3) Excellent Service for Customer What’s more, the service of iPad is very nice. Apple has its own key service iTunes. Customer can get this value to enjoy the all kinds of internet resources such as music, video and applications (As shown in Fig 3.1.4). Fig 3.1.4 iTunes on Apple iPad (source: http://www.ipadforums.net guardian.co.uk guardia guardia) The iTunes online store makes it incredibly easy to purchase songs and load them onto the devices. When customer wants to watch or listen, they neither need to search from the CDs nor television channels. What they need to do is just opening the iTunes, all they want is in iTunes, it let the media browse much faster, it is easier to sort. 4.9 Price â€Å"Price is the amount of money customers have to pay to obtain the product. â€Å" (Philip Kotler, Gary Armstrong, 2009). The iPad is priced starting from $499 for 16 GB storage to $829 for 64GB storage and 3G connectivity. In detail, tab 3.2.1 shows the price of iPad selling in Malaysia. iPad| 16G| 32G| 64G| Wi-Fi| RM 1, 549.00| RM 1, 849.00| RM 2, 149.00| Wi-Fi + 3G| RM 1, 999.00| RM 2, 299.00| RM 2, 599.00| Tab 3.2.1 Selling price of iPad (source: http://www.apple.com guardian.co.uk guardia guardia) Value delivered to customer: 1) Eco-friendly Device for Environment Protection The iPad is made of recyclable glass and Aluminum and the packaging material is recyclable the packing is efficiently done. It is not using Arsenic, PVC, bromine fire, Mercury as the company has restricted the use of harmful chemicals. With such price, customers are not buying the fashionable device only, more importantly, they are making contribution to environment protection. Fig 3.2.1 shows how green is the iPad. Fig3.2.1 How green is the iPad (source: http://sortable.com) 2) Flexible Price as Actual Needs The iPad price varies according to its storage capacity and the internet access capacity, which leads to reducing the initial cost on the first ever tablets based on customer’s actually needs and application (As shown in Fig3.2.2). Fig3.2.2 Price and configuration of the iPad (source: http://www.apple.com) 3) Cost Saving with Maxis Bundled Package It is available on Maxis bundled packages with a 24-month contract based on different types of iPad internet plan (As shown in Fig 3.2.3). By doing so, the price of iPad has been dropped down from RM450 to RM950. The plan is much more attractive not only for those who can’t afford to pay for the high price, but also for some of the SME to extend their business. Fig 3.2.3 Maxis iPad Bundled Packages (source: http://www.maxis.com.my) 4.10 Place â€Å"Place includes company activities that make the product available to target consumers. â€Å" (Philip Kotler, Gary Armstrong, 2009). Apple started selling the iPad not only from its official websites, but also retail outlets and Apple Store. Value delivered to customer 1) Easy Walk-in Location for Purchase The iPad can be purchased from Apple Store, Apple Premium Reseller and Apple Authorized Reseller located in Malaysia. All shops are conveniently located and beautifully designed, identified by the large backlit Apple logo, such as in most famous shopping mall like Sunway Primary, One Utama, KLCC and Mid Valley in Selangor, even in Melaka, Penang, Sabah and Sarawak. The value is so easy for customer to come and have a journey on iPad (As shown in Fig 3.3.1). Fig 3.3.1 Apple shops in Malaysia In each shop, customer will be able to find dedicated Apple-trained and Apple-certified Mac experts who can come up with the right solution for you. 2) Time-Saving Online Order Apple iPad are also available on internet for the customers on Apple’s website. Online purchase is the easiest and time saving way for most of them (As shown in Fig 3.3.2). Fig3.3.2 Online Apple store for iPad (source: http://www.apple.com) On the website, the Apple explains the number of features and benefits of iPad. This adds the value to the consumers as convenience is a value that people appreciate and for which they will pay more than the actual price. 3) Golden Service for Apple Loyalty When customer are on the go, the Apple Store app is the best way to research, personalize and buy products from Apple and get the most out of customer’s visits to the Apple Retail Store for Apple loyal fans. Fig 3.3.3 shows what can do with the Apple Store app on the iPhone or iPod touch from search to pay. Fig3.3.3 Apple store apps for iPhone and iPod Touch (source: http://www.apple.com) 4.11 Promotion â€Å"Promotion means activities that communicate the merits of the product and persuade target customers to buy it. â€Å" (Philip Kotler, Gary Armstrong, 2009) Apple Company had been promoting the iPad with the help of social media campaigns and multi-channel media strategy. Value delivered to customer: 1) Multiple Channel for Better Understanding of iPad The online promotion by Apple on Facebook, YouTube and other related websites approaches to the consumers added more value to the decision of consumers of buying iPad. Same like in stores all the information is available online for customers. Customers can download brochure from its website for their convenience. When Apple announced the idea of iPad, most fans write blogs and share through internet. Customer will see them and many videos about iPad, some of them are made by Apple and some are made by other people. These blogs and videos are shared by many other people through many ways (As shown in Fig 3.4.1). Fig3.4.1 Video sharing about iPad (source: http://www.9to5iPad.com/) 2) Custom Engraving of iPad Apple had offered free iPad engraving from its online store, allowing customers to add a personal touch to the tablet in time for the holiday seasons (As shown in Fig 3.4.2). Customers are given the option to engrave up to 2 lines of free text on the back of an iPad after selecting an iPad model and any desired accessories from the online store. Fig 3.4.2 Website about iPad engraving (Source: http://store.apple.com/) 3) Free Delivery for On-line Purchase When purchasing the iPad online from Apple’s official website, customer will get the value of free delivery. Just wait for 3-4 business days, the product will be arrived on hand safely. 4. Assessment of Overall Value Delivered Apple has always placed a major emphasis on the marketing and the brand awareness of its products. The iPad’s advantage is that they offer several different features in one product. Converging all the new technology into one product is the route apple is seeking. It’s making life easier for their consumers by being able to conduct many applications in the one product. Apple’s iPad followed all the 4P’s of marketing mix to deliver the high level of value to the customers. The company has manufactured an iPad using strong in-built applications. The gadget permits people to work and entertain anytime anywhere, as a value of experiencing its easy and convenient use. It provides value to customers through a huge number of features which helps in saving time and energy. Adding more to customer value the price of iPad is competitive and flexible in the market as discussed above. It advertised on T.V., newspapers, magazine, radios and also on internet, which makes people have clearer understanding in various channel. It provides value by available at all the apple stores and website. From the iPad’s 4P’s analysis, we can easily see the difference of it, and can answer the question â€Å"why people buy it which seems unnecessary product.† Apple iPad satisfy their needs and this delivers the value as a product and service in terms of features, style performance, durability, quality, reliability and design to the customer. 5. Conclusion Apple iPad is a new product which has made a dent in the history of tablet business domain and the first successful product. This has also ignited the demand for new and improved tablets from Apple and other competitors. Apple has used the 4P’s of marketing in a very efficient and proper manner, so that added the value to the customer’s decisions of purchasing iPad. When Apple introduced iPad, they intended to come across the consumer’s wants and demands which would satisfy to their lifestyles. Apple in future which demands more innovative products and the company still need to adapt to expected changes in iPad which they have already started in their new iPad 2. With their experience, they are able to continue strengthen its position in the industry. 6. References 1. Philip Kotler, Gary Armstrong. (2009). Principles of Marketing. (7th Edition). Australia. Pearson. 2. Kotler Brown Burton Deans Armstrong. (2010). Marketing (8th Edition). Australia. Pearson. 3. Borden, N. H. (1964). â€Å"The concept of the Marketing Mix†. Journal of Advertising Research. Vol II 4. APDGT YAMAMOTO. â€Å"Understanding Customer Value Concept: Key To Success†. pp. 547-552. 5. Chapelet, B. and Tovstiga, G. (1998), â€Å"Development of a research methodology for accessing a firm’s business process-related technologies†, International Journal of Technology Management, Vol. 15 Nos  ½, pp. 10-30. 6. Apple Annual Reports, 2010 7. www.apple.com 8. www.maxis.com.my

Special Effects Essay example -- essays research papers

Special Effects Special effects in motion pictures has evolved over the years into an involved science of illusion and visual magic. The following is a comprehensive perspective depicting the rapidly expanding realm of cinematography. In times of old, special effects in movies was limited to an individual's creativity and the constrictive limits of the tools available. However the results of early special effects masters astounded audiences in their age in the same manner that modern artists do today. The ability to create an effect that was brand new was, and still is, the key to the industry. Techniques range from the expected to the bizarre in order to achieve a certain image or illusion. Cinematographers in the early fifties would use a black cloth backdrop with white paint splattered off of toothpicks to simulate a space scene in the many science-fiction movies made in that era. There is also stories of a common plate being thrown across a "space" backdrop to emulate a flying saucer in mid-flight. Although the special effects persons of old were strapped with limits, one of these was not make-up. They relied heavily on this prop to portray the many monsters and aliens in their films. "Nosferatu" a German film about the vampire with the same name was a huge success even in America, where thousands marveled at the intricate detailing of the blood-sucker's razor-like teeth, bulging eyes and a pointed nose and ears. "The Creature from the Black Lagoon" used a somewhat new technique of a body suit that the actor wore along with a mask made of latex rubber and foam. Using cooking oil or butter spread on the body and mask gave an enhancement of sliminess added to the monster image. A fairly recent film using heavy make-up effects is "An American Werewolf in London" done by the master make-up artist Rick Baker who shows what can be done with a steady hand and a lot of patience. Another popular trick used was strings to manipulate miniature objects. Often used in the science fiction era to show spacecraft or other objects in flight was thin strings attached to miniatures. Audiences did notice the obvious strings but it did not matter at the time because it was state of the art. The next major breakthrough in the effects world was stop-motion animation. A process by which objects were... ...l effects has come. The computer age has touched the movie world and made a huge impact. Literally anything is possible with the assistance of computers. Using software and hardware costing in the hundreds of thousands of dollars, 3D mesh object renderings are leaving all other techniques in the past. CGI, which stands for Computer Generated Imaging, is the latest way to get exactly what movie companies want in their films. Flawless in appearance and challenging actual objects the viewer is often left flustered as to if what they are seeing is real or computer generated. Industry giants in this latest technique include Lucas' ILM as well as Pacific Data Images. Movies using mainly CGI include, "Independence Day", "Terminator 2" and, of course, "Jurassic Park". Special effects have played an essential role in the motion picture experience for over 70 years and with good reason. Whether it be a plate being thrown across the screen or a computer generated Star Destroyer, a clay ape on a cardboard Empire State Building or a T-Rex smacking his head on the side of your jeep, the art of movie illusion will only cease to grow when our minds do.

Rhetorical Analysis on the Scarlet Letter Essay

Hawthorne successfully portrays the use of extended metaphors, foreshadowing and language throughout the Scarlet Letter to easily grab hold or grasp the reader’s attentive minds. First of all the utilization of the extended metaphors-the lengthening of the average metaphor was developed in this passage to thoroughly describe Pearls reaction to Reverend Dimmesdale’s approach. â€Å"The child, with bird-like motion which was one of her characteristics, flew to him, and clasped her arms about his knees,† is an extraordinary example of the portrayal of an extended metaphor. By saying that one of Pearls characteristics was having bird-like motion tells the reader she is moving swiftly or gracefully. Then for Hawthorne to say she â€Å"flew to him,† humans can’t fly, therefore extends the metaphor. The effect of this rhetorical device was to amplify the effect of both Pearls and Reverend Dimmesdale’s connection and create an emotional stirring for Hester’s husband, disguised as Old Roger Chillingworth. Hawthorne also developed a successful way to portray sensory details throughout the excerpt to predict, or foreshadow, the coming horror of Dimmesdale’s confession. â€Å"†¦for my own heavy sin and miserable agony-I withheld myself from doing so seven years ago†¦Ã¢â‚¬  helps the reader to connect the dots, they are able to tell what comes next. Dimmesdale is finally coming clean about the sin he committed, created, seven years ago and agrees that he deserves the correct and rightful punishment for his wrongful doing. Hawthorne used this to put the reader in shock and ask questions. The reader can easily predict that the townspeople are going to be furious because the so called â€Å"Man of God† has committed a sinful crime. Finally the way Hawthorne told the story creates a very dark and gloomy setting. Using words such as â€Å"heavy sin†, â€Å"miserable agony†, and â€Å"sin-born† produce a very negative environment and feeling and gives the reader a sense of curiosity and a fearful type of wonderment throughout the passage. Hawthorne uses language to grasp the reader’s attention to make an emotional connection on a more personable level to the reader mind and imagination. Hawthorne effectively demonstrates the purpose of the Scarlet Letter by proficiently portraying the use of extended metaphors, foreshadowing Dimmesdale’s unlawful resignation from the church, and he also uses language to help alter the reader’s mind about the environment or the situation being discussed in the passage.

Master of Business Administration – Semester

Linear programming Is a specific case of mathematical programming (mathematical optimization). More formally, linear programming is a technique for the optimization of a linear objective function, subject to linear equality and linear inequality constraints. (b) A toy company manufactures two types of dolls, a basic version doll- A and a deluxe version doll-B. Each doll of type B takes twice as long to produce as one of type A, and the company would have time to make maximum of 1000 per day. The supply of plastic Is sufficient to produce 1000 dolls per day (both A & B combined).The deluxe version requires a fancy dress for which there are only 500 per day available. If the company makes a profit of RSI 3. 0 and RSI 5 per doll, respectively on doll A and B, then how many of each doll should be produced per day in order to maximize the total profit. Formulate this problem. Mans. Let XSL and XX be the number of dolls produced per day of type A and B, respectively. Let the A require t hr s. So that the doll B require at hrs. So the total time to manufacture XSL and XX dolls should not exceed 20th hrs. Therefore, + text s 20th Other constraints are simple.Then the linear programming problem becomes: Maximize p = ex. ; 5 XA Subject to restrictions, XSL + XX 1500 (Plastic constraint) XX 600 (Dress constraint) And non-negatively restrictions 2. What are the advantages of Linear programming techniques? Mans. Advantages-? 1 . The linear programming technique helps to make the best possible use of available productive resources (such as time, labor, machines etc. ) 2. It improves the quality of decisions. The individual who makes use of linear programming methods becomes more objective than subjective. 3.It also helps in providing better tools for adjustment to meet changing conditions. 4. In a production process, bottle necks may occur. For example, in a factory some machines may be in great demand while others ay lie idle for some time. A significant advantage of linear programming is highlighting of such bottle necks. 5. Most business problems involve constraints like raw materials availability, market demand etc. Which must be taken into consideration. Just we can produce so many units of product does not mean that they can be sold. Linear programming can handle such situation also. 3.Write a note on Monte-Carlo simulation. Mans. Simulation is also called experimentation in the management laboratory. While dealing with business problems, simulation is often referred to as ‘Monte Carlo Analysis'. Two American mathematicians, Von Neumann and Ulna, in the late sass found a problem in the field of nuclear physics too complex for analytical solution and too dangerous for actual experimentation. They arrived at an approximate solution by sampling. The method they used had resemblance to the gambler's betting systems on the roulette table, hence the name ‘Monte Carlo' has stuck.Imagine a betting game where the stakes are based on correct pre diction of the number of heads, which occur when five coins are tossed. If it were only a question of one coin; most people know that there is an equal likelihood of a head or a tail occurring, that is the probability of a head is h. However, without the application of probability theory, it would be difficult to predict the chances of getting various numbers of heads, when five coins are tossed. Why don't you take five coins and toss them repeatedly.Note down the outcomes of each toss after every ten tosses, approximate the probabilities of various outcomes. As you know, the values of these probabilities will initially fluctuate, but they would tend to stabilize as the number of tosses are increased. This approach in effect is a method of sampling, but is not very invention. Instead of actually tossing the coins, you can conduct the experiment using random numbers. Random numbers have the property that any number is equally likely to occur, irrespective of the digit that has alread y occurred.

What is Mercury essays

What is Mercury essays As anyone who's ever broken a thermometer can attest, mercury is a fascinating substance. It also has an interesting history. Named after the fleet-footed Roman messenger of the gods, mercury has been used for more than 2,000 years. Mercury ore cinnabar has even been found smeared on Neolithic skulls. Its first recorded mention is a reference by Aristotle in the fourth century B.C., a time when the silvery-white, heavy metal was used in religious ceremonies. Spanish miners used mercury to process gold ore for ancient Rome; when their mercury supply ran out, gold production dropped and set in motion the decline of the Roman Empire. Today mercury poses a serious threat, this time environmental. Human beings around the world cause mercury to enter the atmosphere primarily when they burn coal or incinerate waste. Studies from Sweden and Florida suggest that mercury also evaporates from landfills, but only 0.0001 per cent. Groundwater contamination from old dumps is of concern but combustion is the major path via which mercury pollutes the globe. Mercury rarely exists in a free state in nature; it's recovered from red mercuric sulphide in geologically recent volcanic rocks. The world inventory of mined mercury is estimated at 600,000 tonnes, stored mostly in states of the former Soviet Union. (Mercury has not been mined in Canada since 1975.) Scientists estimate that man-made mercury releases are two- to four times greater than those of nature. The typical mercury content of lakes has increased up to sevenfold since industrialization. Acid rain dissolves lake-rock and releases mercury to water. (Granite contains about 0.2 p/m mercury.) With a melting point of minus 38.87C, metallic or elemental mercury (the form used in thermometers) readily vaporizes and can be transported long distances. The vaporization rate of mercury doubles with every 10C temperature increase and its residence time in the atmosphere i ...

Narrative Techniques Used in Shakespeares The Tempest

Narrative Techniques Used in Shakespeares The Tempest There is rigid difference between mimic techniques in theatrical performance and literary representation of the play. In particular, the former allow to demonstrate certain actions and convey feelings with the help of gestures, eye contact, silence, and other nonverbal patterns of behavior.Advertising We will write a custom essay sample on Narrative Techniques Used in Shakespeare’s The Tempest specifically for you for only $16.05 $11/page Learn More In contrast, literary presentation is narrowed to language resources, imagination, and cultural propriety which are the only tools for understanding the boundaries between supernatural and human actions. In this regard, Shakespeare makes use of specific narrative techniques while depicting certain actions and events in his play the Tempest. The playwright resorts to tricky narrative elements that make the play be reminiscent of palimpsest, a world of illusions and fictitious perception. The protagonists of the play refer to different genres and stylistics decides within one discourse to underscore social subordination and concept of freedom. A density of narrative elements used in the play creates dynamics between the character and the plot, motif and problem by including techniques implied by the sources. Those attractive variations ignite explanation and expansion. Due to the fact that The Tempest is more typical of a â€Å"science fiction† genre, a reader expects to see a male protagonist of great intellectual gifts who appears to be isolated and who should exert all his intelligence and power to solve the problem of survival. His solitary existence, hence, is revealed in deficiency in intercourse and cooperation with other characters in the play. Prospero is unlikely to be engage in dialogues with other characters; so, all his solutions seem to be mechanical and even robotic. While analyzing these aspects in general, it is possible to understand whether a character is a hu man or not, associative or reserved. More importantly, a reader can also understand the extra factors influencing characters’ actions, decisions, making contextual means a powerful literary device as well.Advertising Looking for essay on british literature? Let's see if we can help you! Get your first paper with 15% OFF Learn More Protagonists of the play resort to different stylistic genres of communication revealing their social and class affiliation. This can be explicitly viewed in case of Calliban’s speaking in iambic pentameter comparing to Trinculo’s narrative in blank verse. While referring to more advanced and sophisticated verse forms, one can notice Caliban’s superiority and higher social position, which is seen in this poetical expression. In contrast, Trinculo’s narrative is presented in mundane prose, which is typical of working class. Additionally, Caliban’s beauty of the language empowers him with grea ter advantage over Trinculo. His narrative, therefore, provokes more sympathy and compassion as fight for freedom seems much more persuasive when conveyed by poetical means. In general, narrative means that both characters make use of define their social status and affiliation to a particular estate regardless of Calibain’s being enslaved by Prospero. In conclusion, narrative techniques used in Shakespeare’s The Tempest are mostly directed at depicting character’s social affiliation, their intelligence level, and salient features. In particular, through literary representation, it is possible to identify Prospero’s unsociability and reluctance to cooperate with other characters, Caliban’s desperate fight for freedom and rights, and Trinculo’s veritable origin and position in society. Further more, using specific stylistic devices, such as allegory and metaphors, Shakespeare strives to endow the play with a shade of uncertainty, supernatural controlled by the reason. Using language resources and various densities of dialogues and discourses, the author also succeeds in providing fictitious perception of the play.

Act One Plot Summary of Pygmalion

Act One Plot Summary of Pygmalion George Bernard Shaw wrote over forty plays during the course long life of 94 years. Pygmalion, written in 1913, became his most famous work. Check out our article on Shaws biography to learn more about his life and literature. Quick Synopsis Its the tale of a conceited professor of linguistics, Henry Higgins, and the brash, incorrigible young woman named Eliza Doolittle. Higgins sees the cockney girl as a great challenge. Can she learn to speak like a refined English lady? Higgins endeavors to transform Eliza in his own image, and he gets much more than he ever bargained for. Pygmalion in Greek Mythology The title of the play is derived from ancient Greece. According to Greek Mythology, Pygmalion was a sculptor who created a beautiful statue of a woman. The gods grant the artist a wish by making the sculpture come to life. The main character in Shaws play is not a sculptor; however, he does become enamored with his own creation. Plot Summary of Act One Professor Henry Higgins wanders the streets of London, absorbing the local color and studying the various dialects those around him. A crowd of people huddle together, due to the sudden downpour of rain. A wealthy woman tells her adult son, Freddy to hail a taxi. He complains but obeys, bumping into a young woman selling flowers: Eliza Doolittle. She asks a man to buy flowers from her. He declines, but gives her spare change, for charitys sake. Another man warns Eliza that she should be careful; a stranger has been writing down every word she has been saying. The stranger is Prof. Henry Higgins who reveals his shorthand notes. She is distressed, thinking that she is in trouble. Henry rebukes her: HIGGINS: Dont be ridiculous. Whos hurting you, you silly girl? The crowd gives Higgins a hard time when they realize he is a gentleman instead of a policeman. At first, the citizens are quite concerned about the poor flower girl. Eliza expresses her distress (and reveals the nature of the crowd) in the following quote and subsequent stage direction: ELIZA: I aint done nothing wrong by speaking to the gentleman. Ive a right to sell flowers if I keep off the kerb. (Hysterically) Im a respectable girl: so help me, I never spoke to him except to ask him to buy a flower off me. (General hubbub, mostly sympathetic to the flower girl, but deprecating her excessive sensibility. Cries of Dont start hollerin. Whos hurting you? Nobodys going to touch you. Whats the good of fussing? Steady on. Easy, easy, etc., come from the elderly staid spectators, who pat her comfortingly. Less patient ones bid her shut her head, or ask her roughly what is wrong with her. (...) The flower girl, distraught and mobbed, breaks through them to the gentleman, crying mildly.) Oh, sir, dont let him charge me. You dunno what it means to me. Theyll take away my character and drive me on the streets for speaking to gentlemen. Prof. Higgins listens to peoples accents and cleverly recognizes where they are from and where they have been. The crowd is both impressed and perturbed at his uncanny abilities. The rain stops and the crowd disperses. Colonel Pickering, the man who gave Doolittle spare change, is intrigued by Higgins. The professor explains that he can identify a persons origins based solely on phonetics, the science of speech. Meanwhile, Eliza is still nearby, sulking and muttering to herself. Higgins complains that the flower girls speech is an insult to the majestic English language. Yet he also boasts that he is so skilled in phonetics that he could train her to speak like royalty. Pickering reveals his name, explaining that he has written a book on Indian dialects. By coincidence, Higgins had been hoping to meet the distinguished Colonel, just as Col. Pickering had been hoping to meet Higgins. Delighted by their chance encounter, Higgins insists that Pickering stay at his home. Before they leave, Eliza begs them to buy some of her flowers. Higgins drops a large amount of coins into her basket, amazing the young woman who very likely has never paid so much. She celebrates by taking a taxi cab home. Freddy, the wealthy young man who originally hailed the taxi says Well, Im dashed, in response to the flower girls confident attitude.

Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.

What main objectives did the British and Russian Empires pursue in the Research Paper

What main objectives did the British and Russian Empires pursue in the course of the Great Game in Central Asia and Afghanistan - Research Paper Example This rivalry spanned years and periods in the lives of the people affected by the rivalry. It also went through different phases in for the countries concerned. This paper shall now discuss the objectives which the British and Russian Empires had in the course of the Great Game in Central Asia and Afghanistan. It shall provide the historical beginnings of the rivalry, including its highlights and significant events. It shall also discuss the significant objectives which the empires had in the Great Game. It shall also highlight the rivalry of the empires in Afghanistan and in Central Asia, as well as the impact and the overall goals achieved in these nations by these empires. Body Britain and Russia were involved in a major rivalry in Central Asia at the start of the nineteenth century; this went on to the early 1900s (Szczepanski, 2011). Much of Britain’s reasons for wanting control and influence over Central Asia have been tied in with its goal to establish a British India. Russia, on the other hand, was seeking to increase its territory as a means of establishing the largest empire in the world, and if gaining India from Britain would ensure this goal then it was willing to secure any means to conquer India (Szczepanski, 2011). ... This convention also set forth the border zone between these two empires, and later declared Afghanistan part of the British protectorate. Despite the establishment of this convention, the relationship between these two empires remained strained and tension-filled. This tension was somehow minimized when these territories allied with each other during the First World War. Specific details of this â€Å"Great Game† shall be discussed forthwith. In the latter part of the 19th century, the Russian and British Empire showed stirrings of a conflicting and tense meet-up. As Russia was expanding its power and territories to its east and southern borders, Britain’s power over its empire and territories was being threatened (Johnson, 2006). When British interests in India were also threatened, Britain became fully determined to secure its interests. This period marked a major rivalry between these two empires, and this ‘Great Game’ became clearly apparent in Europe and well into the Far Eastern region of Asia (Johnson, 2006). Prompted by Russia’s seeming interest in India, Britain increased its military activities in Afghanistan and Tibet, and many of these military activities were often disastrous for the countries involved (Johnson, 2006). From the early 18th to mid-19th centuries, Russia exercised its power over India which was then under British control. The Russians were not able to gain as much progress in terms of empirical conquests in the 1700s and 1800s, but in the 19th century, they were seriously posing a threat on India. The distance between the British and Russian empires was also starting to close in, and both empires were now aiming to conquer as much land as the land that lay between

Prophet Muhammad and rise of Islam Movie Review Example | Topics and Well Written Essays - 500 words

Prophet Muhammad and rise of Islam - Movie Review Example In this part, Gardner attempts to change the association of Islam with violence by portraying Prophet Mohammed both as a warrior and a man of faith. For example there are a number of scenes in this part where Prophet Mohammed is depicted as a forgiving conqueror who opposed any form of bloody revenge and violence. Islam Is also depicted as a religion based on knowledge. This is particularly achieved through a number of recounts of the famous Islamic centers of learning during the medieval times. The last part of the movie covers a number of important historical features beginning from the fall of Rome, The Ottomans, the European explorations and an account of the cruel Islamic Jihadist and Christian crusade wars that were considered excessively brutal even in the standards of the medieval periods. This part has also effectively depicted the history of the expansion of the ancient Ottoman Empire as well as the reign of some of its most powerful Sultans such as Sultan

UK Regulatory Framework for Corporate Governance Dissertation

UK Regulatory Framework for Corporate Governance - Dissertation Example They have to rely on the directors’ judgement in running the company. If the information were freely available to all the firm’s stakeholders at the same time, there wouldn’t have been a need for corporate governance. Therefore, the need of corporate governance has arisen in order to facilitate an effective, prudent and entrepreneurial management, which can deliver long run success of the firm (FRC, 2010, p.1). It is a mechanism as to how the vision and values of the firm are set by the board of the firm distinguished from the regular operational management of the firm by its executives. Corporate governance defines the relationship between various stakeholders such as shareholders, directors, management, employees, creditors, suppliers, customers, government, and regulators, and ensures accountability, integrity and transparency (Mead & Sagar, 2006, p.334). 1.1.1 Aims & Objectives This paper aims to explain the effectiveness of the corporate governance framework by which UK companies are regulated. The effectiveness of the corporate governance practices has been analyzed through the understanding the development of UK’s Combined Code on corporate governance. 1.1.2 Scope of the Paper In order to achieve this paper’s aims and objectives, guidelines of FRC over the Combined Code has been carefully analyzed. The analysis of the effectiveness of corporate governance code has been done on the basis of research papers previously published in the related field. The first section of the paper reviews the literature explaining UK corporate governance code, development of the corporate governance code and practices since 1992, and link between audit assurance and corporate governance. The second section presents the research methodology. The third section presents the findings on the effectiveness of the evolved combined code of corporate governance. This followed by the discussion and conclusion. 2 Chapter 2 2.1 Literature Review 2.1.1 Corporate Governance Codes The Corporate Governance Code in UK is founded on ‘comply or explain’ approach (FRC, 2010, p.4). The approach requires that the companies should comply with the Code and if it is unable to comply with any particular aspect of the Code then it should explain in its financial disclosures. The approach is widely accepted and appreciated by the corporations. The Code does not provide rigid rules but consists of principles and provisions. Compliance with the principles and reporting the same to the shareholders is required under the Listing Rules. The principles given in the Code are as follows: Leadership: Every Company should have an effective board that is collectively responsible for the success of the company. Responsibilities of running the board and running the company’s operations should be clearly defined and divided. The powers of decision should not be fettered to single person. The chairman of the board is responsible for leadin g the board and for oversight of the workings of management. The non-executive board members should challenge and assist develop the proposals on

Elderly Abuse and Neglect in the United States Essay

Elderly Abuse and Neglect in the United States - Essay Example At another context, it involves taking or misusing an elderly persons money or property (Lindberg, 2008). It should be noted that it is not only what is done, but also the failure to do what should be done that can count as elderly abuse; consider situations where the elder is neglected, unfed, and untreated for sickness. This happens in reality, whether done purposefully by the caretaker or merely due to neglect. Actions against the older person such as over- or under-medicating, depriving the elder of food and water, or exposing the elderly to severe weather are all considered as elder abuse, whether intentional or unintentional (Keita, 2007). Elder abuse can happen in hospitals or nursing homes. Take for example the case of Jennifer Matthew Nursing Home in Rochester, New York. An investigation was started at the nursing facility due to suspicions of elderly abuse. Family members agreed that cameras be put in relative’s bedrooms and the living facilities in order to prove negligent care on the part of the nursing facility. The captured videos showed residents left in their own waste for hours, unmoved in their beds for days, in overheated rooms, and left without a call button to ask for help or assistance (ABC News, 2006). The conditions are outright sickening, much more so to think that the nursing staff was just seen watching movies, sleeping and even leaving the facility. It does not reflect well of how elders should be treated, which should be with care, kindness, and attention as they have once cared for us and have been there to watch over us and help us grow. On January 20th 2006, after much controversy, the nursing home was finally closed due to grave cases of neglect. This is not the only case of elderly abuse. Sadly, there are many similar cases of elder abuse across the country. A study conducted by the minority staff of the Special Investigations Division of the House Government Reform Committee

UK Regulatory Framework for Corporate Governance Dissertation

UK Regulatory Framework for Corporate Governance - Dissertation Example They have to rely on the directors’ judgement in running the company. If the information were freely available to all the firm’s stakeholders at the same time, there wouldn’t have been a need for corporate governance. Therefore, the need of corporate governance has arisen in order to facilitate an effective, prudent and entrepreneurial management, which can deliver long run success of the firm (FRC, 2010, p.1). It is a mechanism as to how the vision and values of the firm are set by the board of the firm distinguished from the regular operational management of the firm by its executives. Corporate governance defines the relationship between various stakeholders such as shareholders, directors, management, employees, creditors, suppliers, customers, government, and regulators, and ensures accountability, integrity and transparency (Mead & Sagar, 2006, p.334). 1.1.1 Aims & Objectives This paper aims to explain the effectiveness of the corporate governance framework by which UK companies are regulated. The effectiveness of the corporate governance practices has been analyzed through the understanding the development of UK’s Combined Code on corporate governance. 1.1.2 Scope of the Paper In order to achieve this paper’s aims and objectives, guidelines of FRC over the Combined Code has been carefully analyzed. The analysis of the effectiveness of corporate governance code has been done on the basis of research papers previously published in the related field. The first section of the paper reviews the literature explaining UK corporate governance code, development of the corporate governance code and practices since 1992, and link between audit assurance and corporate governance. The second section presents the research methodology. The third section presents the findings on the effectiveness of the evolved combined code of corporate governance. This followed by the discussion and conclusion. 2 Chapter 2 2.1 Literature Review 2.1.1 Corporate Governance Codes The Corporate Governance Code in UK is founded on ‘comply or explain’ approach (FRC, 2010, p.4). The approach requires that the companies should comply with the Code and if it is unable to comply with any particular aspect of the Code then it should explain in its financial disclosures. The approach is widely accepted and appreciated by the corporations. The Code does not provide rigid rules but consists of principles and provisions. Compliance with the principles and reporting the same to the shareholders is required under the Listing Rules. The principles given in the Code are as follows: Leadership: Every Company should have an effective board that is collectively responsible for the success of the company. Responsibilities of running the board and running the company’s operations should be clearly defined and divided. The powers of decision should not be fettered to single person. The chairman of the board is responsible for leadin g the board and for oversight of the workings of management. The non-executive board members should challenge and assist develop the proposals on

Moghul Muslim Art Essay Example | Topics and Well Written Essays - 2000 words

Moghul Muslim Art - Essay Example Modern scholars have also tended to misinterpret these images, either as a sign of Mughal cultural capitulation to the West, or as a brief and superficial fad for exotica. Both views misunderstand the Emperors' intentions and underestimate their learning and shrewdness. The Mughals consciously appropriated Euro-Christian art as a vehicle for their message of universal supremacy and divinity. Indeed, the Mughal saints' pictures did not simply serve an aesthetic function, but played a vital role in the culture of the Mughal court.2 The Emperors and their artists took on Catholic art because they were intrigued by its affinities with Islamic, Mongol, Hindu, and especially Sufi symbols and themes, and entranced by its realism and spiritual energy. In the foregoing analysis, focusing on Manohar's art, the Western European influence on the Moghul Muslim artistic genre will be highlighted and its implications investigated. Manohar began his career in the 1580s, but only developed a style truly his own by the 1590s.3 Manohar spent the 80s and early 90s collaborating with his father, Basawan,4 on manuscript illustrations, and also imitated his works in the European style. More so than Basawan, Manohar came to appreciate European paintings and engravings, and by the advent of the third Jesuit mission in 1595 he appears to have succeeded Kesu Das as Akbar's chief specialist in Christian art. He later used his skills in pictorial realism to serve Jahangir as one of his principal portraitists. Manohar's early work, likely produced around 1590, after the court had moved to Lahore (1585), does not yet exhibit the love for crowded scenes and pageantry which characterized his work from the mid-l590s.5 Distinct from his father's style and that of the earlier Moghul painters, is a tendency toward crisp, hard outlines and a more linear treatment of modelling, with less interest in spatial depth.6 His drawings have a very finished, burnished appearance characterised by a reticent elegance. When comparing Manohar's paintings with those of his father and other earlier Moghul painters such as Kesu Das, one finds that even though their influence is apparent, there are evident differences. Differences, for example, are clear in Manohar's version of Basawan' s Jerusalem drawing, in Tehran.7 Here, Manohar has copied the earlier work [Fig. 62] with extreme precision, and has even worked out the problem of drapery more logically than his father, but it feels colder. The figure on the left, adapted from Basawan's Guimet 3619.J.a., is also given a more solid, finished appearance than its model-the artist has combed her hair and trimmed her weeds. Another work in a similar vein, although also betraying the influence of Kesu Das, is a high-quality painting in Boston depicting a Basawan-style woman enthroned in a palace interior with an attendant.8 Like many of the scenes of courtly life, this picture places the women in a pavilion reminiscent of Kesu Das' St. Matthew [Fig. 42]. The parted red curtain, shaded in the subtler manner of Manohar, reveals the usual "mystical chapel," complete with altar, chalice, and a censer or vigil light. Typically, Manohar has closed off the landscape with a wall, narrowing the depth of the scene.9 The central

Jesus Christ Essay Example for Free

Jesus Christ Essay What are some ways the Christian gospel is perceived in our culture? Unfortunately, the Christian gospel is perceived negatively by many people I have encountered in everyday life. Many believe Christianity is a list of â€Å"do’s† and â€Å"don’ts† to which they are not willing to subscribe. Others believe the Christian gospel is one of many paths to heaven. Still, others consider the Christian gospel to be mythological. 2. What are some specific moral reasons people may reject the Christian gospel? People may reject the Christian gospel due to the belief that an all-knowing, all-powerful and loving God would not allow injustice or suffering to exist in the world. Another reason people may reject the Christian gospel is because they cannot believe a loving God would allow anyone to suffer for eternity in hell. 3. What are some specific emotional reasons people may reject the Christian gospel? I have heard numerous people reject the Christian gospel, because of the actions of a few â€Å"bad apples† that have ruined their impression of Christians in general. Therefore, they discount all Christians as â€Å"hypocrites† and reject the Christian gospel entirely. Another emotional reason that a person may reject the gospel is that someone close to them has endured hardship, illness or death that was a â€Å"good person† and they feel this would never happen if God was real. 4. What are some specific intellectual reasons people may reject the Christian gospel? People may reject the Christian gospel, for intellectual reasons, because they cannot comprehend that Jesus Christ was God in human flesh. They cannot comprehend that Jesus Christ could die and then be resurrected, because, in their minds, this defies logic and reason. 5. What can Christians do to address these objections and better communicate the Christian gospel? In order to better communicate the gospel, it is important to be non-argumentative and respectful of the other person’s beliefs when sharing the gospel message. As Christians, we can address these objections by citing the Scriptures, while at the same time putting the message in language that the layman can understand.

Osteoprotegerin as Biomarker for Inflammatory Bowel Diseases

Osteoprotegerin as Biomarker for Inflammatory Bowel Diseases Osteoprotegerin: a novel faecal biomarker in paediatric inflammatory bowel diseases Abstract Background: Recently, Osteoprotegerin (OPG) has been identified as a faecal biological marker reflecting intestinal inflammation in inflammatory bowel diseases (IBD). To maintain remission, it is important to prevent relapses, especially in paediatric IBD where failure to thrive is frequently seen. This study aims to identify the diagnostic and predictive value of faecal OPG in paediatric IBD management. Methods: Stool samples, disease activity index scores and inflammatory markers were recorded from children diagnosed with CD or UC during regular visits every three months. An enzyme-linked immunoassay was used to measure faecal OPG levels in these children. Introduction Crohn’s disease (CD) and ulcerative colitis (UC), both an inflammatory bowel disease (IBD), are severe, chronic diseases affecting the gastrointestinal tract. CD occurs throughout the whole gut but is commonly seen near the ileum, whereas UC is mainly restricted to the colon. IBD deteriorates the intestinal mucosa and causes barrier disruption of the gut leading to abdominal pain, diarrhoea and rectal bleeding [1,2]. A worrisome increase in the world-wide IBD population, particularly in developed countries, has been seen over the past decades [10]. Therefore, early diagnosis and early treatment are important key factors in IBD management, especially in children where IBD causes failure to thrive and impairs growth and pubertal development [13]. Etiologically, our understanding of the etiopathogenesis in IBD is still not completely elucidated but our best hypothesis poses that inflammation of the intestinal mucosa is induced by the intestinal flora causing a deregulated immune response in both the innate and the adaptive immune system often in patients with predisposed genetic factors [14-18]. Currently, colonoscopy, albeit unpleasant, invasive and expensive, delineates mucosal inflammation and is the â€Å"gold standard† in diagnosing and monitoring IBD [11,12]. Consequently, many investigators conducted studies to inflammatory indicators trying to find less-invasive and more accessible ways of assessing gastrointestinal inflammation. Several indices have been developed and validated, however not any as sensitive and specific as colonoscopy [39,40]. Also, inflammatory markers such as C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) have been studied but do not differentiate among several other inflammatory diseases. [37,38]. Nowadays, non-invasive faecal markers are deemed promising in diagnosing and monitoring IBD since previous studies have shown non-invasive faecal markers to reflect intestinal inflammation and mucosal healing [42-45]. In intestinal inflammation, one of the inflammatory pathways is the Nuclear Factor (NF)- ÃŽ ºB pathway controlling inflammatory response and modulated by (pro)-inflammatory mediators such as tumor necrosis factor (TNF)-ÃŽ ±, interleukin (IL)-1 and osteoprotegerin (OPG) [19,20]. OPG or TNFRSF11B is a protein and member of the Tumour Necrosis Factor Receptor (TNFR) superfamily. OPG was first described in bone metabolism where it decreases bone-breakdown modulating the OPG/receptor activation of NF-ÃŽ ºB (RANK)/ RANK ligand (RANKL) pathway. In bone, RANK, which is expressed on osteoclast progenitor cells, binds RANKL and thereby inducing osteoclastogenesis. OPG, expressed by osteoblasts and acting as a decoy receptor for RANK, shows competitive binding with RANKL subsequently preventing a RANK-RANKL ligation and bone breakdown [24,25]. Since both RANKL and OPG are members of the TNFR-family and thus affecting several inflammatory mediators and cytokines (e.g. TNF-ÃŽ ±, IL-1, IL-8 and in terferon (IFN)-ÃŽ ³) the OPG/RANK/RANKL pathway also modulates inflammation. Moreover RANKL is synthesized by T-cells whereas OPG is produced by B-cells and dendritic cells (DC) indicating an even more evident role for both proteins in the immune system [26-29]. Although the exact role of OPG in inflammation is yet to be found, recently conducted studies clearly highlight a potential role for OPG as a non-invasive faecal marker in paediatric IBD. Several studies postulate OPG as a promising non-invasive faecal marker since OPG correlates positively with inflammation markers (e.g. C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR)) and IBD index scores [20,30-32]. Moreover, OPG levels decrease significantly after IBD treatment indicating less inflammation [32-34]. In addition, increased OPG levels were not only found in serum but also in intestinal mucosa and stool indicating a distinct role for OPG in intestinal inflammation [20,30-32,34,41]. The aim of this study is to describe levels of OPG with respect to disease state and whether OPG levels change over time while receiving treatment or on behalf of the relapse-remitting pattern of IBD. Furthermore we evaluate the diagnostic and predictive value of OPG as a non-invasive biological marker in paediatric IBD. Methods Patients All patients ( Disease assessment Assessment of patients’ disease activity was measured using the Paediatric Crohn’s Disease Activity Index (PCDAI) for CD patients or the Paediatric Ulcerative Colitis Activity Index (PUCAI) for patients diagnosed with UC. PCDAI scores comprise symptoms (e.g. abdominal pain), physical examination (e.g. peri-rectal disease) and blood results (haematocrit, ESR and albumin) whereas PUCAI scores are only based on subjective symptoms characterizing UC [7-9]. However, previous studies have indicated PCDAI as a poor indicator of intestinal inflammation since it is not correlating well with faecal biomarkers such as calprotectin, lactoferrin and S100A12 [3-5]. Therefore a modified PCDAI was developed and validated based on merely blood parameters (haematocrit, ESR and albumin) [6]. Eventually, both the PCDAI and the modified PCDAI were used for disease assessment in CD patients. CD or UC patients were classified as in remission/inactive, mild, moderate or severe disease state. When scoring a PCDAI12.5/17.5 [x1]or PUCAI score over 65 was classified as a severe disease [6-9]. Since the modified PCDAI only differentiates between an in remission/inactive and a severe form of CD, scores between 7.5 and 12.5/17.5 accounted for a mild/moderate disease state [6]. Subsequently, relapses were defined when patients changed from an inactive disease state to a mild, moderate or severe state or showed a ≠¥12.5 point/≠¥40 point increase in PCDAI score [9] or PUCAI score [7,8]respectively. On other hand, improvement was defined as a decrease in PCDAI score of ≠¥12.5 points [9] or a decrease in PUCAI score of ≠¥35 points [7]. [x2] Sample collection Eight stool samples per patient were collected over a period of 30 months as follows: stool samples were obtained every three months for the first year and then every 6 months for one and a half year. Stool samples were collected and immediately stored at 4 °C. After transporting the samples to the laboratory they were aliquoted and stored in a -80 °C freezer. Moreover, inflammation parameters (e.g. CRP, ESR, albumin, haematocrit, and platelet count), weight, length and Body Mass Index (BMI) were recorded during regular visits. As part of patients’ monitoring these visits took place every three months corresponding with collecting stool samples. Faecal extraction After removing stool samples from the freezer, a weighted amount of stool between 250 mg and 400 mg was added to an Eppendorf tube. Then, the same volume (between 250  µL and 400  µL) of buffered saline (PBS) containing 11  µg/mL aprotinin (Sigma), 2.5  µg/mL leupeptin hemisulfate (Sigma) and 0.5 mM 4-(2-aminoethyl) benzenesulfonyl fluoride (Sigma) was added creating a 1:1 ratio weight/volume. Next, samples were agitated on a vortex machine (Global Science, Auckland, NZ) for 30 seconds and homogenized on a suspension mixer (Gyrotory shaker model G2, New Brunswick Scientific Co, Edison, NJ, US) for 30 minutes. After centrifuging at 13,500g for 10 minutes on 22 °C supernatant was transferred to an Eppendorf tube and stored at -20 °C until analysis. ELISA OPG levels in stool samples were measured using a human OPG/TNFRSF11B ELISA-kit (RD Systems) following the manufactures’ instructions. We used this kit and protocol since it was successfully utilized by Nahidi et al [34]. First, 100  µL per well of capture antibody (mouse anti-human OPG with a working concentration of 2.0  µg/mL in a PBS-dilution) was added to a 96-well plate (Falcon, Corning NY, US) incubating overnight at room temperature. Then, the plate was washed three times with wash buffer (0.05% Tween 20 in PBS pH 7.2-7.4) and tapped dry on paper towel. Next, the plate was blocked by adding 300  µL per well of reagent diluent (1% bovine serum albumin (BSA) in PBS pH 7.2-7.4) incubating for 1 hour at room temperature. Meanwhile, 120  µL of faecal extraction and 120  µL of reagent diluent were added to an Eppendorf tube creating a final 1:2 working dilution of sample. After washing the plate, as aforementioned, 100  µL per well of diluted samples and standard s (recombinant human OPG) were added in duplicates incubating for 2 hours at room temperature. Next, the plate was washed and 100  µL per well of detection antibody (biotinylated goat anti-human OPG with a working concentration of 200ng/mL diluted in reagent diluent with 2% heat inactivated normal goat serum ) was added incubating for two hours at room temperature. Following, after washing, 100  µL per well of Streptavidin-Horseradish peroxidase (HRP) was added for 20 minutes at room temperature and protected against light using tin foil. After washing, 100  µL per well of substrate (H2O2 and Tetramethylbenzidine in a 1:1 dilution) was added for 20 minutes and protected against light. Hereafter 50  µL per well of Stop Solution (2M H2SO4) was added and optical density was immediately analysed using a 450 nm microplate reader (Spectramax 190, Molecular Devices, Sunnyvale, CA, USA). The lower detection limit of this assay was 250 pg/mL. Statistical analysis The obtained data from the microplate reader was calculated using Softmax Pro (version 5.3, October 1998; Molecular Devices, Sunnyvale, CA, USA). [x1]Either 12.5 or 17.5. Differs between articles [x2]Not sure if this is right but found this in other articles

Tribute To Shakespeare Essay -- essays research papers

Tribute to Shakespeare Shakespeare was an English playwright and poet. He is generally considered the â€Å"greatest dramatist the world has ever known† and the â€Å"finest poet who has written in the English language† (World Book Encyclopedia). Shakespeare has also been the world's most popular author. No other writer's plays have been produced so many times or read so widely in so many countries. Many reasons can be given for Shakespeare's appeal. But his fame basically is on his understanding of human nature. Shakespeare understood people as few other artists have. He could see in a specific dramatic situation the qualities that relate to all people. He could create characters that have meaning beyond the time and place of his plays. Yet his characters are not symbolic figures. They are normal individual people. They struggle just as people do in real life, sometimes successfully and sometimes with painful and tragic failure. Shakespeare wrote at least 37 plays, which have been comedies, histories, and tragedies. These plays contain vivid characters of all types. Kings, pickpockets, drunkards, generals, hired killers, shepherds, and philosophers all mingle in Shakespeare's works. In addition to his deep understanding of human nature, Shakespeare had knowledge in a wide variety of other subjects. These subjects include music, law, the Bible, military science, the stage, art, politics, the sea, history, hunting, woodcraft, and sports. Yet as far as scholars know, Shakespeare had no professional experience in any thing other then theater. Shortly after he married at the age of 18, Shakespeare left Stratford to seek his fortune in the theatrical world of London. Within a few years, he had become one of the city's leading actors and playwrights. By 1612, when he seems to have partially retired to Stratford, Shakespeare had become England's most popular playwright. Shakespeare has had enormous influence on culture throughout the world. All the things he wrote have helped shape the literature of all English-speaking countries. He freely experimented with grammar and vocabulary and that helped prevent literary English from becoming fixed and artificial. Many words and phrases from Shakespeare... ...III, Two Noble Kinsmen and the now lost Cardenio were the plays. The former two are no one's favorites, combining elements of spectacle, romance, and tragicomedy. Little is known of the last, except that in 1653 the printer Humphrey Moseley entered in the Stationers' Register several plays including "The History of Cardenio, by Mr. Fletcher and Shakespeare.† and that in 1613 Heminges received payment on two occasions for performances at court of a play at one time called "Cardenno" and another "Cardenna." There are later supposed versions of the play, but little is known of the original (World Book Encyclopedia). In conclusion, his fame basically rests on his understanding of human nature. Shakespeare understood people as few other artists have. He could see in a specific dramatic situation the qualities that relate to all human beings. He could thus create characters that have meaning beyond the time and place of his plays. Yet his characters are not symbolic figures. They are remarkably individual human beings. They struggle just as people do in real life, sometimes successfully and sometimes with painful and tragic failure.

The Internet Piracy

The Pirate Bay -Case Study 1. How does The Pirate Bay business make money? What is its business model? – The Pirate business makes their money by advertising using the â€Å"advertising revenue† as a business model. It’s a website works as a forum to advertise and receives fees from the advertiser. The more browsers the website has, the higher rates of the websites will charge and that’s what lead them to increase their revenue. 2. How do new â€Å"cloud-based† media sites and services make money? What is their business model? * It works through subscription fees by using the â€Å"subscription revenue† as business model.By this the website provides all content or services to their users to exchange for a subscription fee. The users will pay a fee based on what kind of service they want and for how long. 3. Is the record industry justified in attempting to shut down P2P file-sharing sites that make it possible to download copyrighted media? W hy or why not? * Yes it is, since there are millions of dollars spent by record labels to produce albums and not to include the artist’s time and effort into creating music’s and movies for the audience.In my opinion, CD’s, DVD’s can be bit pricy during such difficult economic times, but it will not give people the right to steal. 4. Why might consumers prefer to pay for music from cloud-based sites rather than simply download music from P2P sites? * Because, they get benefits if having instant access of high quality track and videos without the hassle of P2P software download. The consumers don’t have to wait for hours for downloads or clutter their hard drives with file.

The Hunters: Moonsong Chapter Twenty-Six

â€Å"Are you sure you don't want us to cal your parents, miss?† The campus security officer's voice was gruff but kind, and his eyes were worried. For a second, Meredith let herself picture having the kind of parents he must be imagining: ones who would swoop in to rescue their daughter, wrap her up and take her home until the horrible images of her friend's death faded. Her parents would just tel her to get on with the job. Tel her that any other reaction was a failure. If she let herself be weak, more people would die. More so because Samantha had been a hunter, from a family of hunters, like Meredith. Meredith knew exactly what her father would have said if she had cal ed him. â€Å"Let this be a lesson to you. You are never safe.† â€Å"I'l be okay,† she told the security guard. â€Å"My roommates are upstairs.† He let her go, watching her climb the stairs with a distressed expression. â€Å"Don't worry, miss,† he cal ed. â€Å"The police wil get this guy.† Meredith bit back her first reply, which was that he seemed to be putting a lot of faith in a police force that had yet to find any clues as to the whereabouts of the missing people or to solve Christopher's murder. He was only trying to comfort her. She nodded to him and gave a little wave. She hadn't been any more successful than the police, not even with Samantha's help. She hadn't been trying hard enough, had been too distracted by the new place, the new people. Why now? Meredith wondered suddenly. It hadn't occurred to her before, but this was the first death, attack, or disappearance that took place in a dorm room instead of out on the quad or paths of the campus. Whatever this was, it came after Samantha specifical y. Meredith remembered the dark figure she chased away after it attacked a girl, a girl who said she didn't remember anything. Meredith recal ed the flash of pale hair as the figure turned away. Did Samantha die because they got too close to the kil er? Her parents were right. No one was ever safe. She needed to work harder, needed to get on with the job and fol ow up on every lead. Upstairs, Bonnie's bed was empty. Elena looked up from where she was lying, curled up on her bed. Part of Meredith noted that Elena's face was wet with tears and knew that usual y she would have dropped everything to comfort her friend, but now she had to focus on finding Samantha's kil er. Meredith crossed to her own closet, opened it, and pul ed out a heavy black satchel and the case for her hunter's stave. â€Å"Where's Bonnie?† she asked, tossing the satchel onto her bed and unbuckling it. â€Å"She left before I got up,† Elena answered, her voice shaky. â€Å"I think she had a study group this morning. Meredith, what's going on?† Meredith flipped the satchel open and began to pul out her knives and throwing stars. â€Å"What's going on?† Elena asked again, more insistently, her eyes wide. â€Å"Samantha's dead,† Meredith said, testing the edge of a knife against her thumb. â€Å"She was murdered in her bed by whatever's been stalking this campus, and we need to stop it.† The knife could be sharper – Meredith had been letting her weapons maintenance slide – and she dug in the bag for a whetstone. â€Å"What?† Elena said. â€Å"Oh, no, oh, Meredith, I'm so sorry.† Tears began to run down her face again, and Meredith looked over at her, holding out the bag with the stave in it. â€Å"There's a smal black box in my desk with little bottles of different poison extracts inside it,† she said. â€Å"Wolfsbane, vervain, snake venoms. We don't know what we're dealing with exactly, so you'd better fil the hypodermics with a variety of things. Be careful,† she added. Elena's mouth dropped open, and then, after a few seconds, she closed it firmly and nodded, wiping her cheeks with the backs of her hands. Meredith knew that her message – mourn later, act now – had been received and that Elena, as always, would work with her. Elena put the stave on her bed and found the box of poisons in Meredith's desk. Meredith watched as Elena figured out how to fil the tiny hypodermics inset in the ironwood of the stave, her steady fingers pul ing them out and working them cautiously open. Once she was sure Elena knew what she was doing, Meredith went back to sharpening her knife. â€Å"They must have come after Samantha on purpose. She wasn't a chance victim,† Meredith said, her eyes on the knife as she drew it rhythmical y against the whetstone. â€Å"I think we need to assume that whoever this is knows we're hunting him, and that therefore we're in danger.† She shuddered, remembering her friend's body. â€Å"Samantha's death was brutal.† â€Å"A car tried to run me and Damon down last night,† Elena said. â€Å"We had been trying to investigate something weird in the library, but I don't know if that's why. I couldn't get a look at the driver.† Meredith paused in her knife sharpening. â€Å"I told you that Samantha and I chased away someone attacking a girl on campus,† she said thoughtful y, â€Å"but I didn't tel you one thing, because I wasn't sure. I'm stil not sure.† She told Elena about her impressions of the black-clad figure, including the momentary impression of paleness below the hoodie, of almost white hair. Elena frowned, her fingers faltering on the staff. â€Å"Zander?† she asked. They both looked at Bonnie's unmade bed. â€Å"She real y likes him,† Meredith said slowly. â€Å"Wouldn't she know if there was something wrong with him? You know†¦Ã¢â‚¬  She made a vague gesture around her head, trying to indicate Bonnie's history of visions. â€Å"We can't count on that,† Elena said, frowning. â€Å"And she doesn't remember the things she sees. I don't think he's right for Bonnie,† she continued. â€Å"He's so – I mean, he's good-looking, and friendly, but he seems off somehow, doesn't he? And his friends are jerks. I know it's a long way from having terrible friends to being dangerous enough to do something like this, but I don't trust him.† â€Å"Can you ask Stefan to watch him?† Meredith asked. â€Å"I know you're taking a break from dating, but this is important, and a vampire would be the best one to keep an eye on him.† Stefan looked so sad the other night, she thought distantly. Why shouldn't Elena cal him? Life was short. She felt the blade of the knife against her thumb again. Better. Putting the sharpened knife down, she reached for another. Elena wasn't answering, and Meredith looked up to see her staring hard at the stave, her mouth trembling. â€Å"I – Stefan isn't talking to me,† she said in a little burst. â€Å"I don't think – I don't know if he'd help us.† She closed her mouth firmly, clearly not wanting to talk about it. â€Å"Oh,† Meredith said. It was hard to imagine Stefan not doing what Elena wanted, but it was also clear that Elena didn't want to ask him. â€Å"Should I cal Damon?† she suggested reluctantly. The older vampire was a pain, and she didn't real y trust him, but he was certainly good at being sneaky. Elena sucked in a breath and then nodded briskly, her mouth set. â€Å"No, I'l cal him,† she said. â€Å"I'l ask Damon to investigate Zander.† Meredith sighed and leaned back against the wal , letting the knife drop onto her bed. Suddenly, she was terribly tired. Waiting for Samantha in the gym that morning seemed like a mil ion years ago, but it stil wasn't even lunchtime. She and Elena both looked at Bonnie's bed again. â€Å"We have to talk to her about Zander, don't we?† Elena asked quietly. â€Å"We have to ask her whether he was with her al last night. And we have to warn her.† Meredith nodded and closed her eyes, letting her head rest against the coolness of the wal , then opened them again. Tired as she was, she knew the images of Samantha's death would come back to her if she let herself pause for even a moment. She didn't have time to rest, not while the kil er was out there. â€Å"She's not going to be happy about it.†

Jewish Culture Essay

The first Jewish custom, Brit Milah also known as circumcision, takes places at the birth of a boy baby. It is carried out on the eighth day after the baby has been born; it is performed by a Mohel, where the baby’s foreskin of the penis is removed. The second Jewish custom is called The Naming Ceremony, which takes place on the first Sabbath that immediately follows the birth of a baby girl. This event takes place inside of a synagogue. On this day either parents or just the father is called for a blessing and a reading to the torah. The third Jewish custom is the Bat/ Bar Mitzvah, this ceremony marks and commemorates the entry of a young Jew into the Jewish adult community. This ceremony has been in practice for the last 450 years. The person concerned in the Mitzvah is required to read the Haftorah which is the portion of the Torah for the week and then give a scholarly comment or speech. Bat Mitzvah is the name of the ceremony for girls, and Bar Mitzvah is the name of the ceremony for boys. Ideal gift would include; Mezuzah cases, Charity boxes, and or Kiddush cups. The fourth Jewish custom is called a Simcha, which is also known as Marriage, and it is performed under a canopy. The fifth Jewish customs is called The Mikovaot this ceremony is a cleansing bath that is a ritual and is one of the longest standing practices in Jewish customs. This ceremony is performed to endow marriages. Orthodox Jewish women are required to dip themselves in this bathe very month after their menstruation before they resume relations of marriage with their husbands. Language: there are various Jewish languages and dialects that developed in the Jewish communities around the world. Hebrew was the daily speech of the Jewish people for centuries, but by the fifth century the closely related Aramaic joined Hebrew as the spoken language in Judea. By the third century Jews of diaspora were speaking Greek and soon afterwards Hebrew was no longer used as a mother tongue. For centuries Jews worldwide spoke the local or dominant languages of the region migrated to, where they would develop distinctive dialectal forms or branching off as independent languages. Among the most widely spoken Jewish languages to develop in the diaspora are; Yiddish and Ladino. Yiddish is the Judeo- German language developed by Ashkenazi Jews who migrated to central Europe. Ladino is also called Judezmo and Muestra Spanyol is the Judeo- Spanish language developed by Sephardic Jews who lived in the Iberian Peninsula. Religion: the Jewish religion is the monotheistic based on the belief in a single all powerful God. The Jewish doctrine is based on the Ten Commandments as spelt out in the Old Testament. The Hebrew bible had provided the foundations for Christianity. Jesus, Mary and the Apostles were all Jews and the origin of many Christian festivals, psalms and beliefs lay in Judaism. The Jews refused to convert to the new faith of Christianity which is called the New Testament, so they stubbornly maintained their separate religious beliefs and their distinct customs and laws. The Jews also have a Shabbat which takes place on the seventh day of the Jewish week and is the Jewish day for rest. Jew recall the biblical creation account in Genesis in which God creates the Heaven and Earth in six days and rests on the seventh day. Immigration trends: the Jews of Eastern Europe began to emigrate in large numbers from their homelands, beginning in the 1880’s. Between 1881 and 1914 about 2,370,000 Jews fled from poverty and oppression, especially from Trarist Russia notorious for its violent anti- Jewish mobs and pogroms. A great number of these Jews reached the United States and a small minority would establish the first modern Jewish settlements in Palestine. By 1924 the United States had placed strict limits on immigration and the number of Jews admitted was drastically decreased. Other countries soon followed suit and Jews desiring to emigrate or flee from the Nazis found themselves faced with sealed boarders throughout most of the world in the 1930’s. Foods: the Jews have a set of laws about the food they can and cannot eat, these laws are called Kashrut, and a food that is not in accordance with the Jewish law is called Treif. In the Kashrut law, there are prohibitions to consume species (such as pork and most insects), the mixtures of meat and milk, and the commandment to slaughter mammals and birds according to a process known as Shechita. Most of the basic laws of Kashrut are from the Torah’s books of Leviticus and Deuteronomy. The Torah does not state the reason for most of the Kashurt laws, but for every law that the Kashurt has each one is biblically written in the bible. Some of the Jewish favourite foods include the following; Babka which is a chocolate – filled challah (egg) bread. Bagel is another favourite Jewish food that is boiled and baked yeast bread. Bialy which similar to bagel, filled with onions and other ingredients there is also Brisket it is a raised meat from the chest area of a cow. Challah is another favourite food it is braided egg bread, Charoset is an apple and nut dish generally served at Passover. Cholent/ Chamin are a slow- cooked stew meat, potatoes, beans and barley. Another favourite dish is Chopped liver, Chrain and pickled horseradish. Farfel is small pellet- shaped egg pasta, used in dishes like kugel. Goulash is a meat stew matzaball soup, and last but not least the Jews love to drink Chicken soup on Friday and Saturday nights. Community events: the Jews have their Synagogues where they have their Jewish celebrations. The Jewish community also celebrates Passover, when the Jews celebrate Passover they are not allowed to use any electricity, and they light candles. The Hanukah is the festival of lights; they also celebrate the Rosh Hashanah which is the Jewish New Year.

Usefulness of Accounting Theory to Practicing Accountants Today Research Proposal

Usefulness of Accounting Theory to Practicing Accountants Today - Research Proposal Example Throughout history, the need for a single and unified conceptual framework which will embody the needs of the business organization for financial reporting has been a pressing concern. The lack of established accounting theory to support the reporting of financial transactions and the production of financial reports called for the foundation of financial reporting. Without accounting theory, accountants grapple with the difficulty of producing reports which will clearly represent the company’s performance. Comparison and benchmarking cannot be accomplished since reporting is not supported by the same foundation. The need for a conceptual framework is even highlighted by the era of globalization which aims the creation of a single global village. However, it should also be noted that the usefulness of accounting theory is limited by the adherence of accountants which utilizes it. The financial fiascos that shook the global community highlight the need for a more stringent contr ol and adherence to the reporting process in order to produce financial reports which fully embodies the financial position of a business organization. In the early 1800s, accounting theories were random and ill-defined. Development was unstructured and the formalization of existing practices was still in the very preliminary stages. Scientific development was also quite ad hoc and inconsistent, yet 42 bulletins were already developed before 1970. These facts help magnify the importance of having a united adaptable system for the accounting profession to work consistently. The normative period began to emerge in 1956 and developed until 1970. This stage allowed the development of a set of norms for accounting practices and the commencement of the conceptual framework for accounting. It was divided into two dominant groups—the conceptual framework and the critics of historical cost. As the normative era was not being successfully accepted by the community the period ended as financial theories, and computer databases led to empirical research.

General psychology Essay Example | Topics and Well Written Essays - 500 words

General psychology - Essay Example However, if this stage is not successfully resolved the adolescent will continue to feel lost and unguided during adulthood. In contrast Marcia expanding on Erikson's theory of psychosocial development adding new stages that he believed adolescents chronologically progress through. Erikson believed that adolescents are heavily influenced by their peers and role models. These influences may hinder the development of the self. Marcia expanded Erikson's theory on psychosocial development. Marcia believed that adolescents experienced four identity statuses. Moreover Marcia believed that adolescents can be divided into categories of the egos identity statuses based upon their experiences. In contrast to Erikson Marcia believed that adolescents face another stage of identity development based upon their chronological development. This stage can be determined if the adolescent has experienced a crisis and formed a commitment. Adolescents that have achieved a crisis and formed a commitment are considered to have achieved an identity. Adolescents that do not perceive social norms and rules established by parents, teachers or other authority figures are deemed in the foreclosure stage.